Tannin Acyl Hydrolase Production by Citrobacter sp. isolated from Tannin rich Environment, using Tamarindus indica seed powder

Bacterial isolate, Citrobacter sp., from tannery effluent loaded sites has proved as a potent producer of tannase. Production of tannase was compared in solid-state and submerged fermentation using tamarind seed as sole carbon source. Two times increase in tannase activity was seen in solid-state fermentation (90 U) than submerged fermentation (50 U) at 48 h from 5 g substrate @ JASEM Tannase (tannin acyl hydrolase, E.C. 3.1.1.20) is an inducible extracellular microbial enzyme. It catalyses the hydrolysis of ester and depside bonds in hydrolysable tannin such as tannic acid releasing glucose and gallic acid. The enzyme is found to be useful in many food and industrial applications like manufacture of instant tea, acron wine, coffeeflavoured soft drinks, clarification of beer and fruit juices. Gallic acid is mainly used as an important substrate for the synthesis of propyl gallate, which is widely used as a food antioxidant and trimethoprim, a pharmaceutical antibacterial agent (Mohapatra et al, 2007). Even though presence of tannase was reported in plants and animals, microorganisms like fungus and bacteria are used for the industrial production. Fungus like Aspergillus (Pinto et al, 2001; Sabu et al, 2005) and bacteria such as Bacillus (Mondal et al, 2000a; b), Lactobacillus (Ayed and Hamdi, 2002; Sabu et al, 2006) were proved as potent producer of tannase. Fermentation using agro-residue, especially solid-state fermentation (SSF) has various advantages like low capital investment, better product recovery and less water output (Rojan et al, 2005). According to Sabu et al. (2005; 2006) agro residues are the best substrates for tannase production by bacteria or fungi. In the current study a bacterium Citrobacter sp. isolated from the nearby areas of tannery effluent loaded site was characterized by biochemical methods. Its capacity of tannase production was studied using synthetic and commercial medium containing agro-residues. MATERIALS AND METHODS Water and soil samples were collected from nearby area of tannery and microorganisms were enriched in LB broth. Screening was carried out by plating after serial dilution on M9 minimal medium agar containing 0.5 %, w.v tannic acid as sole carbon source. Selected strains were characterized using standard biochemical tests by following Bergey’s manual of determinative bacteriology (Bergey et al, 1923). Attempt was also made to amplify the 16S rRNA gene for identification of selected strain. The primers used to amplify the gene are 16S F 5’CCGAATTCGTCGACAACAGAGTTTGATCCT GGCTCAG 3’ and 16S R 5’CCCGGGATCCAAGCTTACGGCTACCTTGTT ACGACTT 3’. Tannase production was checked by the spectrophotometric and visual reading method (Osawa and Walsh, 1993) and utilization of tannic acid by plate assay. Selected colonies were subjected to tannase activity by allowing them to grow in LB broth containing 0.5 %, w.v tannic acid. Tannase activity was estimated at an interval of 24 h after inoculation (10 c.f.u. grown in LB broth) by the method of Sharma et al. (2000), for three days. Strain having highest activity was selected for the solidstate and submerged fermentation using tamarind seed powder as carbon source. Five gram tamarind (Tamarindus indica) seed powder was used in both cases. Submerged fermentation was done in 250 ml Erlenmeyer flask containing 97 ml distilled water and 3 ml mineral salt solution (NH4NO3:MgSO4.7H2O:NaCl = 5:1:1). The tamarind seed powder moistened with mineral solution and distilled water (70 %, w.w moisture) was used as SSF medium. After inoculation SmF was carried out at 30 oC at 180 rpm in an orbital shaker and the SSF flasks were incubated in an environmental chamber at same temperature. RESULTS AND DISCUSSION Six morphologically different isolates obtained from the tannin rich environment were tested for the degradation of tannic acid. Swam plate assay proved the degradation ability of the test strain by forming clear zone in oxidized tannic acid (brown colour) (Fig.1). Tannin Acyl Hydrolase Production by Citrobacter sp. isolated from Tannin rich Environment, using Tamarindus indica seed ............ * Corresponding author: Sabu Thomas 96 Table 1 Important biochemical test results for the identification of bacterial isolate ‘-‘: negative, ‘+’ : positive Fig. 1 Swarm plate assay showing utilization of tannic acid as sole carbon source was confirmed by chemo taxis. Initially the whole plate was brown in colour. After 18-24 hrs, chemo taxis was detected by movement of cells from the centre (zone of carbon depletion) of the plate towards periphery (zone of carbon sufficiency). As the bacteria moved from the centre to periphery, a clear zone was formed in the centre, indicating degradative ability of isolates. The plates acquired a dark brown color (presumably because of the oxidation of tannic acid). a. Citrobacter sp. (Test